IntroductionRespiratory syncytial virus (RSV) causes widespread respiratory infections worldwide and is recognized as one of the most prevalent and serious respiratory pathogens in children1. Vulnerable populations primarily include infants, the elderly and immunocompromised individuals. Globally, approximately 33.1 million children are infected with RSV annually2. Due to its high mutation rates as an RNA virus, RSV presents challenges in disease control and leads to recurrent infections3. Currently, there are no approved small molecule drugs to treat RSV infections, which contribute to approximately 150,000 annual deaths globally, with the majority occurring in developing countries2. Although three vaccines and two prophylactic monoclonal antibodies have been approved, RSV treatment represents a clear unmet medical need4,5. In conclusion, RSV imposes a serious global disease burden, underscoring the critical need for further exploration into its pathogenicity and molecular mechanisms.Understanding the molecular and cellular mechanisms of RSV infection is critical for developing effective and safe therapeutic and preventive agents5,6. Experimental animal models are essential for this development. The selection of appropriate animal models for RSV is crucial for investigating viral pathogenesis and developing treatment strategies7. Previous studies have employed various animal models to study RSV infection, including mice, cotton mice, chimpanzees, cattle, and sheep. Due to the ease of care, low cost, and the availability of scientific tools, mice are frequently used to model RSV infection3,8.RSV is primarily transmitted through contact with virus-containing secretions or pollutants from the nasopharyngeal mucosa or the mucous membranes of the eyes3. Direct contact is the most common route of transmission, but droplets and aerosols can also cause transmission10. Different infection routes/methods for pathogens other than RSV usually yield different research outcomes. For example, lung injury and viral load in mice differ following intratracheal versus intranasal administration of influenza virus11. Similarly, disease manifestation and mortality patterns in ferrets vary following intranasal versus intratracheal infection7,12. In murine models of RSV infection, the predominant method of infection was intranasal inoculation. Previous research13 assessed multiple pathological and immunological parameters in BALB/c mice following intratracheal intubation (ITT) and intranasal inoculation (INO) of RSV-A2; the research found that INO elicited more severe pathology and inflammation than ITT, suggesting its superiority in RSV infection studies. Besides ITT, intratracheal instillation (ITS) technology is also used to deliver a variety of agents to the lungs, ranging from pathogens and toxins to therapeutic agents14. Natural human coughing is better mimicked by ITS, which results in the lungs being filled with the virus in large amounts within a short time. Direct lung infection by respiratory viruses under simulated aspiration conditions should not be underestimated. Our preliminary findings corroborate the aforementioned conclusions ITS results in broader pulmonary viral dissemination compared to ITT during viral challenge. Furthermore, ITT causes substantial airway trauma, thereby precluding its suitability as a modeling approach. ITS has been successfully utilized in modeling adenovirus infection in the lungs15. However, its application in the modeling of RSV infection has not been reported, nor has it been compared with INO in the case of RSV infection.RNA sequencing (RNA-seq) is a high-throughput technology that enables comprehensive and quantitative analysis of gene expression profiles in specific tissues or cells under defined experimental conditions. It serves as a powerful tool for gaining profound insights into biological processes, disease mechanisms and drug development16. Immunoinfiltration analysis assesses immune cell infiltration in tumors or tissues to reveal the pivotal role of immune cells in disease occurrence, development, and treatment response17. Immunoinfiltration analysis elucidates the distribution, quantity and function of different immune cell subsets in specific tissues, thereby providing novel insights into disease diagnosis and treatment. RNA-seq provides a rich data source for immune infiltration analysis due to its capability to yield extensive gene expression profiles. RNA-seq provides a robust data foundation for immunoinfiltration analysis owing to its capability to generate comprehensive gene expression profiles. Through RNA-seq data, the type, quantity and functional status of immune cells in tissues can be inferred indirectly, thus achieving a comprehensive assessment of immune infiltration18. Based on this rationale, we utilized RNA-seq to characterize pulmonary immunoinfiltration patterns in RSV-infected murine models.In this study, we introduced the ITS method into murine model of RSV infection and performed comparative analysis with the conventional INO method; data showed that ITS method resulted in more efficient viral replication and more severe pathological changes than INO method. Subsequent RNA-seq technology was used to sequence the lung tissues of mice infected by RSV with ITS method, and further immunoinfiltration analysis based on transcriptomic profile demonstrated that RSV infection in mice with the ITS approach can model and replicate major immune infiltration observed in humans, including the infiltration of multiple innate and adaptive immune cells.Materials and methodsCells and virusHEp-2 cells (ATCC CCL-23) were cultured in Dulbecco’s minimal essential medium (DMEM) supplemented with 10% fetal bovine serum (FBS; HyClone) and 1% penicillin-streptomycin19. The cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2. RSV (A2 strain) was propagated in HEp-2 cells for large-scale preparation. UV-inactivated RSV was generated by exposing the RSV virus to UV radiation for 2 h.RSV TitrationTo determine the viral titer, HEp-2 cell monolayers were incubated with serial dilutions of the virus supernatants for 120 min at 37 °C and then overlaid with medium containing 2% FBS and 1% methylcellulose. At 3 days postinfection (dpi), the cells were fixed with 4% polyformaldehyde for 15 min. Subsequently, fluorescent plaques formed through specific antibody binding were observed under a microscope. Plaques were visualized and counted.MiceSpecific-pathogen-free female BALB/c mice, aged 6–8 weeks, were obtained from Guangdong Medical Experimental Animal Center (SCXK(yue)2022-0002) and maintained under standard approved conditions. The mice were fed for one week after arriving in the laboratory to ensure that the mice were normal in weight and health when immunized. Finally, we euthanized mice using an overdose anesthesia method of intraperitoneal injection anesthesia with 3% sodium pentobarbital 60 mg/kg body weight. In our animal experiments, we strictly adhere to the 3Rs principles (Replacement, Reduction, and Refinement). Based on these principles, we calculated the required sample size to ensure statistical validity while minimizing animal use. To further uphold ethical standards, all procedures incorporate comprehensive pain management strategies, including appropriate analgesia and anesthesia. Additionally, predefined humane endpoints are established to promptly euthanize animals showing severe distress or irreversible suffering, ensuring their welfare is prioritized throughout the study. The calculations showed that a sample size of approximately n = 5 is needed for 90% detection power, n = 4 for 80%, and n = 3 for 70%. Consequently, we chose a group size of 5 mice per experimental group. However, due to uncontrollable factors, such as unexpected mouse deaths or the occurrence of outliers, the actual number of mice in the presented data ranged from 3 to 5, ensuring a detection power exceeding 70%. All participants in the experiment had the qualifications and skills to carry out the corresponding animal experiments. The study was approved by the Institutional Animal Care and Use Committee on animal welfare (IACUC No. HTSW221144). This study was conducted in accordance with the ARRIVE guidelines.Infection of miceThe animals were randomly divided into groups. The blank group consisted of mice that did not undergo any treatment. Mice in the RSV groups were infected with 100 µL of 1 × 107 PFU RSV, while mice in the mock groups were infected with 100 µL of 1 × 107 PFU UV-inactivated RSV. The mice were sacrificed and sampled at 0, 1, 4, 7, and 10 days post infection, and the samples were taken, including lung tissue, trachea tissue and turbinate bone tissue. Bodyweight was measured every day until mice were euthanized.Determination of viral titer in mouse lung tissue by ImmunofluorescenceAfter euthanizing the mice, fresh lung tissue was collected and mixed with pre-cooled 2% DMEM. The mixture was placed in pre-cooled EP tubes containing two magnetic beads. The tissue was homogenized in a pre-cooled tissue homogenizer at a frequency of 50 Hz for 30 s, repeated twice. The homogenate was then centrifuged at 4000 g for 15 min at 4 °C in a micro high-speed refrigerated centrifuge (Beckman Coulter, USA). The supernatant was collected and used to determine the viral titer of RSV in mouse lung tissue using the aforementioned immunofluorescence titration method.RNA preparation, reverse transcription and real-time PCRAfter euthanizing the mice, fresh lung tissue, turbinate bone tissue, and tracheal tissue were collected separately and stored in RNA preservation solution (Thermo Fisher, Thermo Fisher Scientific, Shanghai Trade Co.) at -80 °C for further research. Total RNA was extracted from the tissues using TRIzol reagent (Yishan Biotech, Shanghai Yishan Biotech Co., Ltd.). The RNA was then reverse transcribed into cDNA using HiScript IV All-in-One Ultra RT SuperMix for qPCR (Vazyme, Nanjing Vazyme Biotech Co., Ltd.). RSV (Forward: TCTGTCATCCAGCAAATACACC; Reversed: TGTTTCTGCACATCATAATTAGGA), IL-6 (Forward: TGGAGTCACAGAAGGAGTGGCTAAG; Reversed: TCTGACCACAGTGAGGAATGTCCAC), IL-10 (Forward: TGGCTCCTAGCACCATGAAG; Reversed: CGCAGCTCAGTAACAGTCCG), and MIG (Forward: TGCTAGAGGCAAAAACTCTGTG; Reversed: TAGGCTCAAGGGCGTGAT) expression was detected using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Vazyme, Nanjing Vazyme Biotech Co., Ltd.) in a PCR instrument (Biosystem 7500). β-actin (Forward: TGGCTCCTAGCACCATGAAG; Reversed: CGCAGCTCAGTAACAGTCCG) was used as the internal reference.HistopathologyIn order to evaluate lung pathology, the right lower lobe of the mouse lung was taken and immersed in 4% paraformaldehyde for one day. Fixed lungs were embedded in paraffin blocks, sectioned, and stained with hematoxylin and eosin (H&E).Library Preparation and sequencingTotal RNA of lung samples was extracted using TRIzol (Invitrogen) according to the manufacturer’s instructions. RNA quantity and purity were analyzed with an RNA integrity number (RIN) of > 7.0. After extraction, total RNAs were subjected to rRNA removal prior to library preparation. Library construction and RNA sequencing were performed at the Gene Denovo Biotechnology Company (Guangzhou, China).Evaluation of infiltrating immune cellsCIBERSORT is a gene expression-based deconvolution algorithm, and it uses a set of gene expression values for characterizing immune cell composition20. Based on the RNA-seq data, CIBERSORT and CIBERSORT-ABS were used to analyze lung tissue immune infiltrating cells, namely: B cell naive, B cell memory, B cell plasma, T cell CD8+, T cell CD4+ naive, T cell CD4+ memory resting, T cell CD4+ memory activated, T cell follicular helper, T cell regulatory (Tregs), T cell gamma delta, NK cell resting, NK cell activated, Monocyte, Macrophage M0, Macrophage M1, Macrophage M2, Myeloid dendritic cell resting, Myeloid dendritic cell activated, Mast cell activated, Mast cell resting, Eosinophil, and Neutrophil.Statistical methodsThe data in the figures represent mean ± standard deviation (SD). All data were analyzed using GraphPad Prism software. Comparisons between two groups were performed using an unpaired Student’s t-test. Multiple comparisons were analyzed using a one-way analysis of variance (ANOVA). P values were calculated, and statistical significance was expressed as highly significant with *P