Plasmodium falciparum Pfs47 haplotype compatibility to Anopheles gambiae in Kisumu, a malaria-endemic region of KenyaDownload PDF Download PDF ArticleOpen accessPublished: 24 February 2025Shirley A. Onyango1,2,Maxwell G. Machani3,Kevin O. Ochwedo2,5,Robin M. Oriango2,Ming-Chieh Lee4,Elizabeth Kokwaro1,Yaw A. Afrane6,Andrew K. Githeko3,Daibin Zhong4 &…Guiyun Yan4 Scientific Reports volume 15, Article number: 6550 (2025) Cite this articleMetrics detailsSubjectsEvolutionGeneticsMolecular biologyAbstractInsecticide resistance and outdoor transmission have reduced the effectiveness of existing malaria transmission prevention strategies. As a result, targeted approaches to support continuing malaria control, such as transmission-blocking vaccines, are required. Cross-sectional mass blood screening in children between 5 and 15 years was conducted in Chulaimbo, Kisumu, during the dry and wet seasons in 2018 and 2019. Plasmodium falciparum gametocyte carriers were identified by Microscopy. Subsequently, carriers were used to feed colony bred Anopheles gambiae females in serum replacement and whole blood membrane feeding experiments. The infection prevalence was 19.7% (95% Cl 0.003–0.007) with 95% of the infections being caused by P. falciparum. Of all confirmed P. falciparum infections, 16.9% were gametocytes. Thirty-seven paired experiments showed infection rates of 0.9% and 0.5% in the serum replacement and whole blood experiments, respectively, with no significant difference (P = 0.738). Six Pfs47 haplotypes were identified from 24 sequenced infectious blood samples: Hap_1 (E27D and L240I), Hap_2 (S98T); Hap_3 (E27D); Hap_4 (L240I); Hap_5 (E188D); and Hap_6 without mutations. Haplotype 4 had the highest frequency of 29.2% followed by Hap_3 and Hap_6 at 20.8% each then Hap_1 with a frequency of 16.7%, whereas Hap_5 and Hap_2 had frequencies of 8.3% and 4.2% respectively. Varying frequencies of Pfs47 haplotypes observed from genetically heterogeneous parasite populations in endemic regions illuminates vector compatibility to refracting P. falciparum using the hypothesized lock and key analogy. This acts as a bottleneck that increases the frequency of P. falciparum haplotypes that escape elimination by vector immune responses. The interaction can be used as a potential target for transmission blocking through a refractory host.IntroductionInsecticide resistance1,2,3,4 and outdoor transmission5,6,7,8 have compromised the efficacy of primary malaria control interventions, necessitating the development of new or improved targeted strategies that could complement the control of malaria, such as transmission-blocking approaches. Molecular mechanisms underlying Plasmodium infections and mosquito genotypes influencing parasite adaptations to diverse Anopheles species are critical in understanding malaria transmission dynamics and for developing targeted vector control interventions that may compliment already existing ones.Malaria transmission primarily depends on competent vectors and compatible infectious parasites to influence susceptibility in local Anopheles populations9. The mosquito immune factors, including recognition receptors, cellular and humoral components, influence the infectiousness of gametocytes in vectors10. The likelihood of infection after ingesting gametocytes from an infected person is determined by a combination of factors like the mosquito’s immune responses among others10,11,12,13. The thioester-containing protein 1 (TEP1) is an important immunological gene that exhibits allele-linked variations14 and also inhibits pathogens including Plasmodium infections in mosquitoes15, hence altering vector competence and malaria infectivity16,17. In contrast, the malaria parasite P. falciparum has evolved to circumvent the vectors’ immune responses mediated by the Pfs4718,19. The Pfs47 gene displays haplotypes that naturally select specific mosquito midgut receptors resulting in significant transmission variability9. According to Sinka et al.20, around 70 Anopheles species now transmit P. falciparum malaria around the world.Recent studies have revealed that compatible Pfs47 haplotypes are selected by specific vector receptors in the midgut, eluding the immune system and increasing the likelihood of infection. However, incompatible haplotypes are detected and eliminated by the vector’s immune defenses18. Furthermore, selection pressures imposed by local Anopheles populations dominant in a given region may have altered the genetic diversity of Pfs47 haplotypes, resulting in parasite adaptations to native vector species. Therefore, the associations between the TEP1 immunity gene in Anopheles and Pfs47 in P. falciparum may be an important determinant of malaria infections and could be targeted in blocking malaria transmission in primary vectors efficient in transmitting malaria from a molecular perspective. Moreover, Anopheles-Plasmodium interactions are complex and have not been clearly understood yet, form a basis for increasing the knowledge gaps of host factors on vector competence. Also, these interactions are potential targets for developing malaria transmission-blocking interventions. The aim of this study is to determine parasite genotypes and their associations with mosquito infectivity in a malaria-endemic region in western Kenya.Materials and methodsStudy site and populationConsented children aged 5–15 years were screened following a cross-sectional study design from sub locations in Chulaimbo, Kisumu County (Fig. 1), during the wet season from October to December 2019 and October to December 2020, and the dry season (January to March 2020). Site selection was purposive and based on an ongoing study of malaria prevalence and vector distribution. Chulaimbo is a rural site 19 km north-west of Kisumu City, located at 0.03572ºS, 34.621ºE, and an altitude range of 1328–1458 m above sea level21. The region has a mean annual temperature range of 12–35ºC. This region experiences an average annual rainfall of 1352 mm and an average relative humidity between 66 and 83%. Malaria transmission in this area is endemic, with P. falciparum as the dominant parasite species in the area22. Most residents are small-scale subsistence farmers.Fig. 1Map of Chulaimbo, Kisumu County showing the sampling locations. The map was generated using ArcGIS Pro 2.6 software. Map source: ESRI, CGIAR, and USGS (available at: www.esri.com).Full size imageMosquitoes used for the studyLaboratory reared Anopheles gambiae female mosquitoes (Kisumu strain) between 3 and 5 days post-emergence were used for membrane feeding assays. This colony was selected and maintained at the Center of Excellence for Malaria Research in Homa Bay, Western Kenya. They were reared at temperatures of 27–29 °C, 69–80% relative humidity (RH), and a 12 h light and 12 h dark cycle. The colony was then constantly maintained on 10% sucrose23 after the blood meal until the dissection day.Identifying gametocyte carriersParasitological assessments to detect P. falciparum gametocyte carriers were conducted in school-aged children from 5 and 15 years old, who had assented and had their guardians’ consent to participate in the study. Blood samples were obtained from the children using finger pricks on well-labeled Whatman® 903 Protein Saver Cards (GE Healthcare WB100014) with the participants’ information. A total of 50 µl of blood was collected onto the cards, air dried and stored at − 20 °C for further molecular analyses. Thick and thin smears were also prepared for the same participant stained with 10% Giemsa and read after drying. Parasites were viewed under a compound microscope and Plasmodium species identified in thick smears Malaria parasites counts were read against 500 white blood cells. Gametocyte densities were determined in slides for all P. falciparum positive participants by counting the number of gametocytes per 500 leukocytes by microscopy and expressed as parasites per μl assuming a standard white blood cell (WBC) concentration of 8000/μl24. Two trained microscopists took two readings per slide smear, and 20% of the slides were randomly selected for quality control verification by a senior external microscopist. Membrane feeding was limited to slides of gametocyte positive subjects only. Individuals who tested positive for malaria and had symptoms were referred to a local health center and treated according to Ministry of Health recommendations25.Mosquito infections using membrane feeding assaysParticipants’ blood positive for gametocytes was used to infect insectary reared An. gambiae mosquitoes using serum replacement and whole blood experiments in the laboratory26. Blood was drawn intravenously by a professional phlebotomist using butterfly needles. Approximately 3 ml of blood was collected by venipuncture in heparinized tubes for each volunteer. An aliquot of 1 ml of blood was immediately placed into pre-warmed hemotek feeders (1 ml capacity) at 37 °C, while another 1 ml was transferred into 1 ml Eppendorf tubes and centrifuged at 2000 rounds per minute for 2 min before adding it to the hemotek feeders. The supernatant of serum was discarded and replaced with a naïve human serum type AB (Bio Whittaker, Cambrex Bio Science Walkersville, MD, USA). A final volume of 1 ml of replaced blood was then quickly transferred to the feeders to allow the starved mosquitoes to feed. Aggressive 3–5 days old female An. gambiae mosquitoes were starved for 6 to 8 h prior to feeding on infected blood. Whole blood and serum replacement experiments were conducted for each participant. A total of 37 paired experiments were conducted. Each feeding cup contained approximately 100–120 mosquitoes. The mosquitoes were allowed to feed from different feeders of the same infected blood for 15–30 min through a parafilm membrane. All membrane feeding procedures were conducted at 37 °C using the hemotek system. Only fully engorged blood-fed mosquitoes were selected and maintained at 27–29 °C temperatures and 69–80% relative humidity following a 12 h light and 12 h dark cycle. They were given 10% sucrose for 9 days post-feeding and the ones that survived were dissected for midgut oocysts enumeration. The unfed and partially fed mosquitoes were discarded by freezing them for 15 min at − 20 °C. After membrane feeding, volunteers were treated with artemether-lumefantrine (Coartem®) according to the Ministry of Health guideline25.Oocysts countsAll fully engorged mosquitoes that survived on day 8 or 9 post-feeding were dissected under a dissecting microscope as described by Afrane et al.27. Briefly, each mosquito gut was carefully pulled out from the abdomen in 0.5% mercurochrome and allowed to stain for 10 min. The midguts were then examined for the presence of oocysts under a light microscope. The number of oocysts observed were counted and recorded per mosquito gut. The oocysts load was expressed as the number of oocysts per infected mosquito. Slides were read by a technician and confirmed by a second technician. The positive and negative slides were then re-read by a third technician for quality control.Molecular analysis of TEP1 in infected mosquito carcassesMosquito carcasses corresponding to their infected midguts were labeled and preserved for further molecular assays to determine TEP1 genotypes28. Briefly, TEP1 was genotyped using a nested PCR–RFLP targeting 892 base pairs for nest 1 and a final fragment length of 758 base pairs after nest 2. Both PCR reaction conditions were set as denaturation at 95 °C for 3 min, 35 cycles of 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and a final step at 72 °C for 6 min using Dream Taq Green Master Mix (Thermo Fisher Scientific). PCR products were then digested using restriction enzymes Bam HI, Hind III, or Bse NI (New England Biolabs Inc) according to the manufacturer’s instructions and the result analyzed on 2.5% agarose gel electrophoresis. The TEP1 allelic classes were determined by fragment size of restriction enzyme digestion. A subset was also randomly selected for the genotype confirmatory purposes by sequencing.Parasite DNA extraction and Pfs47 genotypingThe Chelex technique was used to obtain P. falciparum gametocytes DNA from the dried blood spots confirmed by microscopy29. As previously reported30, a multiplex real-time PCR (RT-PCR) was utilized to identify Plasmodium species. Pfs47 was genotyped using PCR and Sanger sequencing, as previously published30. Briefly, forward 5’ATGTGTATGGGAAGAATGATCAG3’ and reverse 5’ACAAGTTCATTCATATGCTAACATA3’ primers were used to amplify the coding region 1320 bp from the DNA of P. falciparum gametocyte positive samples. A final reaction volume of 12 μl was prepared by addition of 6 μl of Dream Taq Green PCR Master Mix (2X), 0.5 μl of each of the forward and reverse primer, 3 μl of double distilled PCR grade water, and 2 μl of sample DNA. The PCR conditions were set as follows; 95 °C for 3 min, 35X (94 °C for30 sec, 50 °C for 30 s, 68 °C for 90 s), and 72 °C for 6 min before sequence, amplicons quality and size were determined by visualization of PCR products in 1.5% w/v gel under UV transilluminator. The amplicons were cleaned and sequenced directly using BigDye terminator chemistry v3.1, PCR primers, and PRISM® 3730xl genetic analyzer (Applied Biosystems, CA, USA). Paired reads from the sequencer were edited and assembled using BioEdit software (version 7.2.5) before further analysis.Ethical approvalThe ethical review board of the Maseno University, Kenya (MSU/DRPI/MUERC/00456/17) reviewed and approved the protocol for screening of P. falciparum gametocyte carriers and subsequent intravenous blood drawing. A detailed written informed assent and consent to participate in the study was provided by all study volunteers and their parents or guardians. Feeding of mosquitoes was conducted in a secure, insect-proof room at the Chulaimbo health center. All experiments and methods were performed in accordance with the institution’s guidelines and regulations.Statistical analysisData from the participants was tabulated in Microsoft Excel V16. Computing descriptive statistics (sum, mean, standard deviation, standard error, and 95% confidence interval) and comparing means were done using Graph Pad Prism v.8.0.1 and SPSS version 25 for Windows software. The Shapiro–Wilk normality test was used to check data normality before performing pairwise comparisons and chi-square tests. Data were considered statistically significant at P 20 gametocytes/µl) may not always indicate successful mosquito infection. Conversely, low gametocyte densities (