IntroductionN-ethylmaleimide-sensitive factor (NSF), a homohexameric adenosine triphosphatase (ATPase), is essential for membrane fusion, including inter-cisternal Golgi protein transport and synaptic vesicle exocytosis [1,2,3,4]. NSF dysfunction is implicated in neuropsychiatric disorders, with reduced expression in autism spectrum disorder (ASD) and schizophrenia and aggregates in Parkinson’s disease [5,6,7]. Genetic studies link SNARE complex genes, including NSF-interacting protein genes, to attention-deficit/hyperactivity disorder (ADHD), suggesting NSF-related involvement in ADHD pathophysiology [8].Previously, we showed that NSF interacts with serotonin transporter (SERT) and promotes SERT membrane localization in vitro [5]. To validate this in vivo, we generated Nsf heterozygous (Nsf+/-) mice, which showed reduced membrane SERT and AMPA receptor expression [9]. These mice exhibited ASD-like behaviors, including impaired social communication, repetitive behavior, and anxiety.NSF is expressed in hippocampal, cortical, and subcortical regions, including striatum. In vitro studies show NSF interacts with dopamine receptors D1 (D1R) and D2 (D2R), regulating their membrane localization [10,11]. D2R activation protects neurons from glutamate-induced excitotoxicity through NSF-mediated anti-apoptotic signaling [12,13]. However, the neuroprotective role of the NSF-D2R interaction in vivo remains unclear.D2R is highly expressed in striatal medium spiny neurons, a major component of the basal ganglia indirect pathway. This pathway supports motor control, inhibitory regulation, and reward processing [14]. D2R dysregulation has been implicated in several neuropsychiatric disorders, including ADHD [15]. ADHD is characterized by impaired sustained attention, excessive motor activity, and impulsivity and affects 1.4–3.0% of children and adolescents worldwide [16]. Neuroimaging studies have shown reduced striatal D2R/D3R availability in individuals with ADHD, along with diminished dopamine transporter (DAT) expression and reduced striatal volume [15,17]. These findings suggest that D2R dysfunction contributes centrally to ADHD neurobiology.Although D2R has been extensively studied, the upstream mechanisms regulating its function and localization remain unclear. NSF-D2R interaction, particularly in striatal neurons, may sustain D2R-mediated signaling. To test this hypothesis, we generated D2R-specific Nsf conditional knockout (Nsf f/f;D2R-Cre) mice to examine NSF function in D2R-expressing cells in vivo.Materials and methodsAnimalsThis study followed the ARRIVE guidelines [18]. Nsf f/f;D2R-Cre mice and control littermates (Nsf f/f) were used. All procedures were approved by the Animal Research Committee of the University of Fukui and complied with institutional guidelines and national regulations. Approval numbers were 29078, 30079, R01080, R02084, R03087, R04076, R05073, R06065, R07057, and R08076. Both male and female mice were used throughout the study, except for the tissue dopamine concentration assay (Fig. 3A), which used males only. The main conclusions were drawn from pooled male/female datasets presented in the main figures, and sex-separated behavioral data are provided in the Supplementary Information. Behavioral data were therefore analyzed both as pooled male/female datasets and separately by sex, whereas anatomical, biochemical, and some parts of pharmacological data were analyzed only as pooled male/female datasets because sample sizes were too limited for sex-stratified analyses. Efforts were made to minimize animal use and suffering.Generation of NSF conditional knockout miceTo generate conditional Nsf knockout mice, a targeted Nsf allele was engineered by inserting cDNA into a lacZ-neo cassette [9]. The cassette was flanked by Frt sites, and mice were crossed with B6;SJL-Tg (ACTFLPe) transgenic mice (The Jackson Laboratory, Bar Harbor, ME, USA) to excise the neomycin resistance gene, producing floxed Nsf (Nsff/+) mice.Homozygous Nsf f/f mice were crossed with D2R-Cre mice to generate independent Nsf f/f;D2R-Cre lines. The D2R-Cre line, B6.FVB(Cg)-Tg(Drd2-Cre)ER44Gsat/Mmucd (RRID: MMRRC_032108-UCD), was obtained from the Mutant Mouse Resource and Research Center (MMRRC), University of California, Davis, a National Institutes of Health (NIH)-funded repository [19].In situ hybridizationTo detect mRNA expression of Nsf, D1R, D2R, and proenkephalin (Penk), in situ hybridization was performed with digoxigenin-labeled antisense RNA probes. A plasmid for Nsf probe synthesis was constructed using the pGEM-T kit (Promega, Tokyo, Japan) and an amplified PCR product generated with the following primers: CTTGTCTTTAGCTTCAATGATAA and CGATAAGATTGAGCGACGAA, yielding a 183-bp fragment. Plasmid templates for D1R and D2R probes were provided by Dr. Kazuto Kobayashi [20]. The Penk probe template and in situ hybridization procedures were described previously [21,22]. For Nsf analysis, all morphologically identifiable cells in the analyzed region were included in the denominator. Fluorescent in situ hybridization was combined with NeuN immunostaining to identify neurons. D1R-, D2R-, and Penk-positive cells among NeuN-positive neurons were quantified in dorsal striatum/caudate-putamen (DS/CPu) and ventral striatum/nucleus accumbens (VS/NAc) using ImageJ software.Immunohistochemistry (IHC) and western blot (WB)IHC and WB were performed as previously described by Xie et al. [23]. Striatal samples were dissected from the rostral striatum anterior to the optic chiasm. Primary antibodies are listed in Supplementary Table 1. NeuN- and tyrosine hydroxylase (TH)-immunopositive cells were quantified using ImageJ software.Quantitative real-time reverse-transcription-polymerase chain reaction (qRT-PCR)Total RNA was extracted from the striatum and reverse-transcribed into cDNA using the GeneAce cDNA Synthesis Kit (Nippon Gene Co., Ltd., Tokyo, Japan) according to the manufacturer’s instructions. qRT-PCR was performed using SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are listed in Supplementary Table 2.Measurement of dopamine concentrationsStriatal dopamine concentrations were quantified by Eicom Co., Ltd. using high-performance liquid chromatography (HPLC) with electrochemical detection (ECD-100, Eicom, Kyoto, Japan). Striatal tissues were dissected, frozen in liquid nitrogen, and stored at -80 °C until analysis. Subsequent procedures followed established methods [24].Behavioral testsBehavioral tests were conducted during the light phase (10:00 a.m.–4:00 p.m.), with one test per mouse per day. The behavioral battery, including the open-field test [9], cliff avoidance and jumping test [25,26], elevated plus maze [27], prepulse inhibition (PPI) test, three-chamber social interaction test [9], and rotarod test [28], is described in the Supplementary Methods.Pharmacological experimentsMethylphenidate hydrochloride (MPH; Sigma-Aldrich, St. Louis, MO, USA) and quinpirole hydrochloride (QNP; Sigma-Aldrich) were used to examine the effects of pharmacological modulation of dopaminergic signaling on locomotor activity and impulsive-like behavior. Four-week-old Nsf f/f and Nsf f/f;D2R-Cre mice received intraperitoneal injections of MPH (5 mg/kg), QNP (2 mg/kg), or a combination of MPH (5 mg/kg) and QNP (2 mg/kg). For the open-field test, mice were placed in a novel open-field arena, and locomotor activity was recorded in 5-min bins for a total of 150 min, including a 30-min baseline period before drug administration. The total distance traveled during the 30-min period before injection and the 30-min period from 30 to 60 min after injection was compared. For the cliff-avoidance reaction test, mice were treated with the combination of MPH and QNP. Thirty minutes after drug administration, impulsive-like behavior was assessed by measuring the latency to the first fall from the platform during a 7-min test period.Statistical analysisNormality was assessed using the Shapiro–Wilk test, and parametric or non-parametric tests were selected accordingly. The choice of statistical test was also guided by the data structure, including whether measurements were paired, unpaired, or repeated. Two-group comparisons were analyzed using paired or unpaired t-tests, including Welch’s correction when appropriate, or using the Mann–Whitney test for non-parametric data. Single-factor multiple-group comparisons were analyzed using one-way ANOVA or the Kruskal–Wallis test. Two-factor or repeated-measures designs were analyzed using two-way ANOVA or two-way repeated-measures ANOVA, followed by post hoc tests. Statistical significance was set at p