MainInheritance across generations is traditionally attributed to genetic mechanisms but there is growing evidence that epigenetic processes, such as those involving heritable small RNAs, can transmit environmentally induced traits through the germline. Environmental stimuli, including diet and stress, can reshape the small RNA content of gametes, potentially altering gene expression programs in progeny1,2. In Caenorhabditis elegans, both somatic and germline small RNA pathways have been implicated in the inheritance of acquired traits3,4,5. A central question emerging from these findings is whether gametes can acquire epigenetic molecules, such as small RNAs, from somatic tissues6.In oviparous animals like C. elegans, the yolk is synthesized in somatic tissues, specifically the intestine, starting at the L4 larval stage7 and is rapidly transported to developing oocytes to supply essential lipids and nutrients for embryogenesis8. Yolk proteins, primarily vitellogenins, are synthesized in the endoplasmic reticulum, trafficked by the coat complex II transport vesicle to the Golgi apparatus and then packaged into exocytic yolk granules that fuse with the intestinal plasma membrane for secretion9. These granules are released into the pseudocoelom and then internalized in oocytes by endocytosis through the lipoprotein receptor RME-2 (ref. 10). The internalized yolk granules are stable throughout embryogenesis, providing nutritional support throughout embryogenesis and early larval development11.During mid-embryogenesis, the yolk is reallocated from nonintestinal to intestinal embryonic cells, where it is stored in new vesicles for subsequent use12,13. While the yolk is not strictly essential for embryonic viability in C. elegans14,15,16, it enhances progeny development under stressful conditions such as starvation17,18,19,20 and oxidative stress21. In other taxa, the yolk supports immune priming in offspring22,23 and influences social behavior24. However, the molecular cargo responsible for these effects and the mechanisms of its inheritance remain poorly understood.The possibility that the yolk transports RNA has long been speculated, with early evidence from amphibians suggesting the presence of RNA in yolk granules25. In C. elegans, however, yolk granules have not been biochemically purified and most insights into yolk biology come from imaging studies. Notably, recent work showed that exogenous double-stranded RNAs injected into the pseudocoelom can be cotransported into oocytes by the yolk26,27, raising the question of whether endogenous small RNAs might follow the same route.Motivated by these observations, we developed a biochemical and genetic strategy to test whether the yolk can serve as a physiological conduit for transferring somatic small RNAs to the germline. By purifying the yolk secreted from intestinal cells before oocyte uptake, we identified a specific enrichment of microRNAs (miRNAs). We demonstrate that intestinal miRNAs are transported by yolk granules to oocytes and contribute to the pool of maternally inherited miRNAs in embryos. These yolk-inherited miRNAs promote larval development, particularly under stress, and are modulated by maternal age and environment. Our findings redefine the role of yolk as not merely a nutrient source but also a vehicle for endogenous RNA transport, enabling soma-to-germline communication with gene-regulatory and epigenetic consequences in the next generation.ResultsmiRNAs are transported by yolk through the lipoprotein receptor into C. elegans embryosTo explore whether endogenous small RNAs are transported with yolk into the germline, we first developed a strategy to purify yolk granules before their internalization into oocytes (Fig. 1a). We generated a C. elegans strain that expresses the yolk protein vitellogenin VIT-2 tagged with GFP17 and enables conditional depletion of the RME-2 receptor through auxin-inducible degradation (AID)28 in oocytes by expressing TIR-1 under the control of the germline-specific mex-5 promoter. In the presence of auxin, this RME-2 degron strain accumulated VIT-2::GFP in the body cavity as the yolk cannot be internalized in oocytes and embryos (Extended Data Fig. 1a,b). The RME-2 degron strain allowed us to overcome the fertility and developmental defects observed in the rme-2 mutant10,16.Fig. 1: Yolk contributes to the maternal pool of miRNAs in embryos.The alternative text for this image may have been generated using AI.Full size imagea, Schematic of the VIT-2::GFP yolk purification workflow and small RNA-seq. Genotype of the degron strain used to deplete RME-2 receptor in the germline: gcp88[mex-5p::TIR-1(F79G)::F2A::mTagBFP2::AID*::NLS::tbb-2 3′UTR] (II:0.77); rme-2(gcp080[rme-2::AID::2×HA]) IV; vit-2(crg9070[vit-2::gfp]) X. b, Violin plot showing the log2 fold change of miRNAs, piRNAs and 22G-RNAs between VIT-2::GFP sorted and unsorted small RNA fractions. The dashed line indicates the median. Statistical analysis was performed using two-tailed Mann–Whitney–Wilcoxon tests; ****P 200 nt) fraction using the Quick-RNA MicroPrep kit (ZymoResearch, R1051). The small RNA library preparation was performed essentially as described previously76. Amplified libraries were multiplexed and further purified using PippinPrep DNA size selection with 3% gel cassettes. The following parameters were used for size selection: BP start (133) and BP end (153). The purified libraries were quantified using the Qubit fluorometer high-sensitivity dsDNA assay kit (Thermo Fisher Scientific, Q32851) and sequenced on an Illumina NextSeq 2000 platform.ImmunostainingImmunostaining was performed as described previously76. The worms were permeabilized on slides coated with 0.1% poly(L-lysine) solution (Sigma, P4832-50mL) by freeze-cracking as described previously81. The primary antibody, anti-Flag (Sigma, F1804), at a dilution of 1:500, was incubated overnight at 4 °C in PBS, 0.1% Tween-20 and 5% BSA. The secondary antibody, anti-mouse (Invitrogen, Cy3), was incubated at a dilution of 1:500 for 4 h at room temperature. DNA was stained with DAPI (antifade mounting medium with DAPI, Vectashield, H-1200).Progeny collection from the heterozygote miR-85 mutantTo distinguish progeny that inherit maternal miR-85 without zygotic expression, we used a GFP balancer strategy82. miR-85(n4117) mutants were crossed to mIn1 [mIs14 [myo-2::gfp; pes-10::gfp]; dpy-10(e128)] II, which provides dose-dependent GFP expression. L1 progeny from heterozygous mothers were sorted by COPAS based on fluorescence intensity to isolate homozygous mutants (no GFP) and heterozygotes (intermediate GFP). Sorted worms were grown to L4 and exposed to control (50 mM NaCl) or osmotic stress (300 mM NaCl). Progeny were resorted to obtain (1) homozygous mutants from heterozygous mothers (maternal inheritance only, P0hetG0KO); (2) heterozygotes (maternal + zygotic expression, P0hetG0het); and (3) homozygous mutants from homozygous mothers (no inheritance). Sorted L1 larvae were collected in TRIzol for RNA and small RNA-seq.Sequencing data analysisAll the sequencing data were demultiplexed with Illumina bcl2fastq converter (version 2.17.1.14) and quality control was performed with fastQC (version 0.11.5).RNA-seq analysisHISAT2 (version 2.0.4)83 was used for mapping RNA-seq reads aligned to the C. elegans genome sequence (ce11, C. elegans Sequencing Consortium WBcel235). After alignment, reads mapping to annotated protein-coding genes were counted using featureCounts (version 2.0.1)84. Counted reads for protein-coding genes were used for differential expression analysis using the R/Bioconductor package DESeq2 (version 1.26.0)85.Small RNA-seq analysisThe analysis of small RNA-seq on RNA extracted from the purified yolk, unsorted fraction and total RNAs was performed as previously described76. Yolk-enriched miRNAs were identified using Limma86 with the limma-voom approach87. We selected miRNAs having log2 fold change ≥ 0.5 and P value ≤ 0.05.Spike-in miRNA-seq analysis from two-cell embryosAfter demultiplexing, the 3′ adaptor was trimmed from raw reads using Cutadapt (version 1.15)88 with the parameter ‘-O 5’ and the adaptor (TGGAATTCTCGGGTGCCAAGG) given with option -a. Four randomized nucleotides were trimmed at both ends (option: --cut 4 --cut −4). The selected 18–26-nt reads were aligned to the C. elegans genome sequence (ce11, C. elegans Sequencing Consortium WBcel235) using Bowtie2 (version 2.3.4.1)89 with the following parameters:‘ -L 6 -N 0 -i S,1,0.8 --no-1mm-upfront --score-min L,0,0 --ignore-quals --no-unal’. Aligned reads mapping to annotated genomic features (miRNAs and piRNAs) were then counted using featureCounts (version 2.0.1)84 with the stranded option (-s 1). Counts were normalized in each sample using spike-in counts (scaling factor per sample = 103 × total_nb_spikes_counted/total_nb_reads_aligned) in a dataset. Scaling factors were then generally ‘minimized’; all scaling factors of the dataset were divided by the minor scaling factor in the dataset. Differential expression analysis of miRNAs was performed using Limma86.Tissue enrichment and Gene Ontology enrichment analysesUpregulated and downregulated genes identified in RNA-seq experiments using embryos and larvae from DP degron were analyzed for their tissue and Gene Ontology enrichments as described previously40.Statistics and reproducibilityAlmost all the experiments shown in this study were performed independently at least twice and no inconsistent results were observed. Most of the graphs were generated using GraphPad Prism 10. The log fold changes for all the plots were calculated using the mean of biologically independent replicates. Details of the statistical analyses used, precise P values, statistical significance and sample sizes for all graphs are provided in the figure legends.Reporting summaryFurther information on research design is available in the Nature Portfolio Reporting Summary linked to this article.Data availabilityAll the sequencing data are available at the following accession numbers GSE261340 and GSE261341. The MS proteomics data were deposited to the ProteomeXchange Consortium through the PRIDE partner repository with the dataset identifier PXD064947. Source data are provided with this paper.Code availabilityCustom code and data analysis workflows are available from GitLab (https://gitlab.pasteur.fr/bli/bioinfo_utils). The spike-in miRNA sequencing pipeline is available from GitHub (https://github.com/achervov/C.elegans_miRNAseq_pipeline).ReferencesSkvortsova, K., Iovino, N. & Bogdanović, O. Functions and mechanisms of epigenetic inheritance in animals. Nat. Rev. Mol. Cell Biol. 19, 774–790 (2018).Article CAS PubMed Google Scholar Fitz-James, M. H. & Cavalli, G. Molecular mechanisms of transgenerational epigenetic inheritance. Nat. Rev. Genet. 23, 325–341 (2022).Article CAS PubMed PubMed Central Google Scholar Okabe, E., Uno, M., Kishimoto, S. & Nishida, E. Intertissue small RNA communication mediates the acquisition and inheritance of hormesis in Caenorhabditis elegans. Commun. Biol. 4, 207 (2021).Article CAS PubMed PubMed Central Google Scholar Posner, R. et al. Neuronal small RNAs control behavior transgenerationally. Cell 177, 1814–1826 (2019).Article CAS PubMed PubMed Central Google Scholar Moore, R. S., Kaletsky, R. & Murphy, C. T. Piwi/PRG-1 Argonaute and TGF-β mediate transgenerational learned pathogenic avoidance. Cell 177, 1827–1841 (2019).Article CAS PubMed PubMed Central Google Scholar Conine, C. C. & Rando, O. J. Soma-to-germline RNA communication. Nat. Rev. Genet. 23, 73–88 (2022).Article CAS PubMed Google Scholar Kimble, J. & Sharrock, W. J. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev. Biol. 96, 189–196 (1983).Article CAS PubMed Google Scholar Ramos, I., Machado, E., Masuda, H. & Gomes, F. Open questions on the functional biology of the yolk granules during embryo development. Mol. Reprod. Dev. 89, 86–94 (2022).Article CAS PubMed Google Scholar Zhai, C. et al. Immuno-electron microscopy localizes Caenorhabditis elegans vitellogenins along the classic exocytosis route. Life Metab. 3, loae025 (2024).Article Google Scholar Grant, B. & Hirsh, D. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol. Biol. Cell 10, 4311–4326 (1999).Article CAS PubMed PubMed Central Google Scholar Schneider, W. J. Vitellogenin receptors: oocyte-specific members of the low-density lipoprotein receptor supergene family. Int. Rev. Cytol. 166, 103–137 (1996).Article CAS PubMed Google Scholar Bossinger, O. & Schierenberg, E. Cell–cell communication in the embryo of Caenorhabditis elegans. Dev. Biol. 151, 401–409 (1992).Article CAS PubMed Google Scholar Bossinger, O. & Schierenberg, E. The use of fluorescent marker dyes for studying intercellular communication in nematode embryos. Int. J. Dev. Biol. 40, 431–439 (1996).Article CAS PubMed Google Scholar Ezcurra, M. et al. C. elegans eats its own intestine to make yolk leading to multiple senescent pathologies. Curr. Biol. 28, 2544–2556 (2018).Article CAS PubMed PubMed Central Google Scholar Rompay, L. V., Borghgraef, C., Beets, I., Caers, J. & Temmerman, L. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci. Rep. 5, 16381 (2015).Article CAS PubMed PubMed Central Google Scholar Dowen, R. H. CEH-60/PBX and UNC-62/MEIS coordinate a metabolic switch that supports reproduction in C. elegans. Dev. Cell 49, 235–250 (2019).Article CAS PubMed Google Scholar Perez, M. F., Francesconi, M., Hidalgo-Carcedo, C. & Lehner, B. Maternal age generates phenotypic variation in Caenorhabditis elegans. Nature 552, 106–109 (2017).Article CAS PubMed PubMed Central Google Scholar Jordan, J. M. et al. Insulin/IGF signaling and vitellogenin provisioning mediate intergenerational adaptation to nutrient stress. Curr. Biol. 29, 2380–2388 (2019).Article CAS PubMed PubMed Central Google Scholar Geens, E. et al. Yolk-deprived Caenorhabditis elegans secure brood size at the expense of competitive fitness. Life Sci. Alliance 6, e202201675 (2023).Article CAS PubMed PubMed Central Google Scholar Chotard, L., Skorobogata, O., Sylvain, M.-A., Shrivastava, S. & Rocheleau, C. E. TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans. PLoS ONE 5, e15662 (2010).Article CAS PubMed PubMed Central Google Scholar Sornda, T. et al. Production of YP170 vitellogenins promotes intestinal senescence in Caenorhabditis elegans. J. Gerontol. A Biol. Sci. Med. Sci. 74, 1180–1188 (2019).Article CAS PubMed PubMed Central Google Scholar Salmela, H., Amdam, G. V. & Freitak, D. Transfer of immunity from mother to offspring is mediated via egg-yolk protein vitellogenin. PLoS Pathog. 11, e1005015 (2015).Article PubMed PubMed Central Google Scholar Harwood, G., Amdam, G. & Freitak, D. The role of vitellogenin in the transfer of immune elicitors from gut to hypopharyngeal glands in honey bees (Apis mellifera). J. Insect Physiol. 112, 90–100 (2019).Article CAS PubMed Google Scholar Amdam, G. V., Norberg, K., Hagen, A. & Omholt, S. W. Social exploitation of vitellogenin. Proc. Natl Acad. Sci. 100, 1799–1802 (2003).Article CAS PubMed PubMed Central Google Scholar Kelley, R. O., Nakai, G. S. & Guganig, M. E. A biochemical and ultrastructural study of RNA in yolk platelets of Xenopus gastrulae. Development 26, 181–193 (1971).Article CAS Google Scholar Marré, J., Traver, E. C. & Jose, A. M. Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans. Proc. Natl Acad. Sci. USA 113, 12496–12501 (2016).Article PubMed PubMed Central Google Scholar Wang, E. & Hunter, C. P. SID-1 functions in multiple roles to support parental RNAi in Caenorhabditis elegans. Genetics 207, 547–557 (2017).Article CAS PubMed PubMed Central Google Scholar Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142, 4374–4384 (2015).CAS PubMed PubMed Central Google Scholar Zhai, C. et al. Fusion and expansion of vitellogenin vesicles during Caenorhabditis elegans intestinal senescence. Aging Cell 21, e13719 (2022).Article CAS PubMed PubMed Central Google Scholar Dallaire, A., Frédérick, P.-M. & Simard, M. J. Somatic and germline microRNAs form distinct silencing complexes to regulate their target mRNAs differently. Dev. Cell 47, 239–247 (2018).Article CAS PubMed Google Scholar Zabinsky, R. A., Weum, B. M., Cui, M. & Han, M. RNA binding protein vigilin collaborates with miRNAs to regulate gene expression for Caenorhabditis elegans larval development. G3 (Bethesda) 7, 2511–2518 (2017).Article CAS PubMed PubMed Central Google Scholar Caudy, A. A. et al. A micrococcal nuclease homologue in RNAi effector complexes. Nature 425, 411–414 (2003).Article CAS PubMed Google Scholar Hammell, C. M., Lubin, I., Boag, P. R., Blackwell, T. K. & Ambros, V. nhl-2 modulates microRNA activity in Caenorhabditis elegans. Cell 136, 926–938 (2009).Article CAS PubMed PubMed Central Google Scholar Flamand, M. N. et al. Poly(A)-binding proteins are required for microRNA-mediated silencing and to promote target deadenylation in C. elegans. Nucleic Acids Res. 44, 5924–5935 (2016).Article CAS PubMed PubMed Central Google Scholar Iwasaki, S. et al. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. Mol. Cell 39, 292–299 (2010).Article CAS PubMed Google Scholar Cecere, G. Small RNAs in epigenetic inheritance: from mechanisms to trait transmission. FEBS Lett. 595, 2953–2977 (2021).Article CAS PubMed PubMed Central Google Scholar Hills-Muckey, K. et al. An engineered, orthogonal auxin analog/AtTIR1(F79G) pairing improves both specificity and efficacy of the auxin degradation system in Caenorhabditis elegans. Genetics 220, iyab174 (2022).Dexheimer, P. J., Wang, J. & Cochella, L. Two microRNAs are sufficient for embryonic patterning in C. elegans. Curr. Biol. 30, 5058–5065 (2020).Article CAS PubMed PubMed Central Google Scholar Jan, C. H., Friedman, R. C., Ruby, J. G. & Bartel, D. P. Formation, regulation and evolution of Caenorhabditis elegans 3′UTRs. Nature 469, 97–101 (2011).Article CAS PubMed Google Scholar Angeles-Albores, D., Lee, R. Y. N., Chan, J. & Sternberg, P. W. Tissue enrichment analysis for C. elegans genomics. BMC Bioinform. 17, 366 (2016).Article Google Scholar Sharrock, W. J. Yolk proteins of Caenorhabditis elegans. Dev. Biol. 96, 182–188 (1983).Article CAS PubMed Google Scholar Perez, M. F. & Lehner, B. Vitellogenins—yolk gene function and regulation in Caenorhabditis elegans. Front. Physiol. 10, 1067 (2019).Article PubMed PubMed Central Google Scholar de Lucas, M. P., Sáez, A. G. & Lozano, E. miR-58 family and TGF-β pathways regulate each other in Caenorhabditis elegans. Nucleic Acids Res. 43, 9978–9993 (2015).PubMed PubMed Central Google Scholar Nehammer, C., Podolska, A., Mackowiak, S. D., Kagias, K. & Pocock, R. Specific microRNAs regulate heat stress responses in Caenorhabditis elegans. Sci. Rep. 5, 8866 (2015).Article CAS PubMed PubMed Central Google Scholar de Lencastre, A. et al. MicroRNAs both promote and antagonize longevity in C. elegans. Curr. Biol. 20, 2159–2168 (2010).Article PubMed PubMed Central Google Scholar Kudlow, B. A., Zhang, L. & Han, M. Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the C. elegans pathogen response. Mol. Cell 46, 530–541 (2012).Article CAS PubMed PubMed Central Google Scholar Smith-Vikos, T. et al. MicroRNAs mediate dietary-restriction-induced longevity through PHA-4/FOXA and SKN-1/Nrf transcription factors. Curr. Biol. 24, 2238–2246 (2014).Article CAS PubMed PubMed Central Google Scholar Guo, T. et al. The C. elegans miR-235 regulates the toxicity of graphene oxide via targeting the nuclear hormone receptor DAF-12 in the intestine. Sci. Rep. 10, 16933 (2020).Article CAS PubMed PubMed Central Google Scholar Pagliuso, D. C., Bodas, D. M. & Pasquinelli, A. E. Recovery from heat shock requires the microRNA pathway in Caenorhabditis elegans. PLoS Genet. 17, e1009734 (2021).Article CAS PubMed PubMed Central Google Scholar Ren, Z. & Ambros, V. R. Caenorhabditis elegans microRNAs of the let-7 family act in innate immune response circuits and confer robust developmental timing against pathogen stress. Proc. Natl Acad. Sci. USA 112, E2366–E2375 (2015).Article CAS PubMed PubMed Central Google Scholar Zhu, C. et al. The lin-4 gene controls fat accumulation and longevity in Caenorhabditis elegans. Int. J. Mol. Sci. 11, 4814–4825 (2010).Article CAS PubMed PubMed Central Google Scholar Vergani-Junior, C. A. et al. An intricate network involving the Argonaute ALG-1 modulates organismal resistance to oxidative stress. Nat. Commun. 15, 3070 (2024).Article CAS PubMed PubMed Central Google Scholar Metheetrairut, C., Adams, B. D., Nallur, S., Weidhaas, J. B. & Slack, F. J. cel-mir-237 and its homologue, hsa-miR-125b, modulate the cellular response to ionizing radiation. Oncogene 36, 512–524 (2017).Article CAS PubMed Google Scholar Karp, X., Hammell, M., Ow, M. C. & Ambros, V. Effect of life history on microRNA expression during C. elegans development. RNA 17, 639–651 (2011).Article CAS PubMed PubMed Central Google Scholar Burton, N. O. et al. Insulin-like signalling to the maternal germline controls progeny response to osmotic stress. Nat. Cell Biol. 19, 252–257 (2017).Article CAS PubMed PubMed Central Google Scholar Burton, N. O. et al. Intergenerational adaptations to stress are evolutionarily conserved, stress-specific, and have deleterious trade-offs. eLife 10, e73425 (2021).Article CAS PubMed PubMed Central Google Scholar Lamitina, S. T., Morrison, R., Moeckel, G. W. & Strange, K. Adaptation of the nematode Caenorhabditis elegans to extreme osmotic stress. Am. J. Physiol. Cell Physiol. 286, C785–C791 (2004).Article CAS PubMed Google Scholar Thomou, T. et al. Adipose-derived circulating miRNAs regulate gene expression in other tissues. Nature 542, 450–455 (2017).Article CAS PubMed PubMed Central Google Scholar Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D. & Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat. Cell Biol. 13, 423–433 (2011).Article CAS PubMed PubMed Central Google Scholar Martinez, J., Patkaniowska, A., Urlaub, H., Lührmann, R. & Tuschl, T. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110, 563–574 (2002).Article CAS PubMed Google Scholar Gibbings, D. J., Ciaudo, C., Erhardt, M. & Voinnet, O. Multivesicular bodies associate with components of miRNA effector complexes and modulate miRNA activity. Nat. Cell Biol. 11, 1143–1149 (2009).Article CAS PubMed Google Scholar Lee, Y. S. et al. Silencing by small RNAs is linked to endosomal trafficking. Nat. Cell Biol. 11, 1150–1156 (2009).Article CAS PubMed PubMed Central Google Scholar Ghoshal, B., Bertrand, E. & Bhattacharyya, S. N. Non-canonical Argonaute loading of extracellular vesicle-derived exogenous single-stranded miRNA in recipient cells. J. Cell Sci. 134, jcs253914 (2021).Article CAS PubMed Google Scholar Jeppesen, D. K. et al. Reassessment of exosome composition. Cell 177, 428–445.e18 (2018).Article Google Scholar Gapp, K. et al. Implication of sperm RNAs in transgenerational inheritance of the effects of early trauma in mice. Nat. Neurosci. 17, 667–669 (2014).Article CAS PubMed PubMed Central Google Scholar Rodgers, A. B., Morgan, C. P., Bronson, S. L., Revello, S. & Bale, T. L. Paternal stress exposure alters sperm microRNA content and reprograms offspring HPA stress axis regulation. J. Neurosci. 33, 9003–9012 (2013).Article CAS PubMed Google Scholar Rodgers, A. B., Morgan, C. P., Leu, N. A. & Bale, T. L. Transgenerational epigenetic programming via sperm microRNA recapitulates effects of paternal stress. Proc. Natl Acad. Sci. USA 112, 13699–13704 (2015).Article CAS PubMed PubMed Central Google Scholar Sharma, U. et al. Small RNAs are trafficked from the epididymis to developing mammalian sperm. Dev. Cell 46, 481–494 (2018).Article CAS PubMed PubMed Central Google Scholar Wang, H. et al. Small RNA shuffling between murine sperm and their cytoplasmic droplets during epididymal maturation. Dev. Cell 58, 779–790 (2023).Article CAS PubMed PubMed Central Google Scholar Nguyen, T. Unravelling the mysteries of microRNA in breast milk. Nature 582, S12–S13 (2020).Article CAS Google Scholar Brawand, D., Wahli, W. & Kaessmann, H. Loss of egg yolk genes in mammals and the origin of lactation and placentation. PLoS Biol. 6, e63 (2008).Article PubMed PubMed Central Google Scholar Kern, C. C. et al. C. elegans feed yolk to their young in a form of primitive lactation. Nat. Commun. 12, 5801 (2021).Article CAS PubMed PubMed Central Google Scholar Mailho-Fontana, P. L. et al. Milk provisioning in oviparous caecilian amphibians. Science 383, 1092–1095 (2024).Article CAS PubMed Google Scholar Stiernagle, T. Maintenance of C. elegans. In WormBook (The C. elegans Research Community, 2006).Paix, A., Folkmann, A., Rasoloson, D. & Seydoux, G. High efficiency, homology-directed genome editing in Caenorhabditis elegans using CRISPR–Cas9 ribonucleoprotein complexes. Genetics 201, 47–54 (2015).Article CAS PubMed PubMed Central Google Scholar Barucci, G. et al. Small-RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants. Nat. Cell Biol. 22, 235–245 (2020).Article CAS PubMed PubMed Central Google Scholar Dokshin, G. A., Ghanta, K. S., Piscopo, K. M. & Mello, C. C. Robust genome editing with short single-stranded and long, partially single-stranded DNA donors in Caenorhabditis elegans. Genetics 210, 781–787 (2018).Article CAS PubMed PubMed Central Google Scholar Poullet, P., Carpentier, S. & Barillot, E. myProMS, a web server for management and validation of mass spectrometry-based proteomic data. Proteomics 7, 2553–2556 (2007).Article CAS PubMed Google Scholar The, M., MacCoss, M. J., Noble, W. S. & Käll, L. Fast and accurate protein false discovery rates on large-scale proteomics data sets with Percolator 3.0. J. Am. Soc. Mass. Spectrom. 27, 1719–1727 (2016).Article CAS PubMed Google Scholar Wickersheim, M. L. & Blumenstiel, J. P. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries. BioTechniques 55, 269–272 (2013).Article CAS PubMed PubMed Central Google Scholar Duerr, J. S. Antibody staining in C. elegans using ‘freeze-cracking’. J. Vis. Exp. 80, e50664 (2013).Edgley, M. L., Baillie, D. L., Riddle, D. L. & Rose, A. M. Genetic balancers. In WormBook (The C. elegans Research Community, 2006).Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods 12, 357–360 (2015).Article CAS PubMed PubMed Central Google Scholar Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general-purpose program for assigning sequence reads to genomic features. Preprint at https://doi.org/10.48550/arxiv.1305.3347 (2013).Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).Article PubMed PubMed Central Google Scholar Ritchie, M. E. et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 43, e47 (2015).Article PubMed PubMed Central Google Scholar Law, C. W., Chen, Y., Shi, W. & Smyth, G. K. voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 15, R29–R29 (2014).Article PubMed PubMed Central Google Scholar Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17, 10–12 (2011).Article Google Scholar Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).Article CAS PubMed PubMed Central Google Scholar Download referencesAcknowledgementsWe would like to thank all the members of the G.C. laboratory, N. Iovino and A. Andersen for the helpful discussions on the paper and suggestions on the project. We thank the L. Cochella (Johns Hopkins University) and B. Lehner (European Molecular Biology Laboratory Center for Genomic Regulation Systems Biology Research Unit in Barcelona) laboratories for sharing strains and reagents. Some strains were provided by the Caenorhabditis Genetics Center, funded by the National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440). This project has received funding from the Institut Pasteur, Centre National de la Recherche Scientifique and European Union’s Horizon 2020 research and innovation program (grant agreement no. 101002999). N.A. was supported by a LabEx Revive Doctoral Fellowship (ANR-10-LABX-0073). M.S. was supported by the Pasteur–Roux–Cantarini Postdoctoral Fellowship Program.Author informationAuthor notesThese authors contributed equally: Névé Aupérin, Meetali Singh.Authors and AffiliationsMechanisms of Epigenetic Inheritance Unit, Department of Developmental and Stem Cell Biology, Institut Pasteur, CNRS UMR3738, Université Paris Cité, Paris, FranceNévé Aupérin, Meetali Singh, Loan Bourdon, Almira Chervova, Julie Ovieve, Aikaterini Gkaraveli & Germano CecereCollège Doctoral, Sorbonne Université, Paris, FranceNévé AupérinParasite Epigenetics Lab, Developmental Biology and Genetics, Indian Institute of Science, Bangalore, IndiaMeetali SinghBioinformatics and Biostatistics Hub, Department of Computational Biology, Institut Pasteur, CNRS USR 3756, Paris, FranceAlmira Chervova & Hélène Lopez-MaestreCytometry and Biomarkers UTechS, Institut Pasteur, Paris, FrancePierre-Henri CommereCentre de Recherche, CurieCoreTech Mass Spectrometry Proteomics, Institut Curie, PSL Research University, Paris, FranceFlorent Dingli & Damarys LoewAuthorsNévé AupérinView author publicationsSearch author on:PubMed Google ScholarMeetali SinghView author publicationsSearch author on:PubMed Google ScholarLoan BourdonView author publicationsSearch author on:PubMed Google ScholarAlmira ChervovaView author publicationsSearch author on:PubMed Google ScholarJulie OvieveView author publicationsSearch author on:PubMed Google ScholarPierre-Henri CommereView author publicationsSearch author on:PubMed Google ScholarHélène Lopez-MaestreView author publicationsSearch author on:PubMed Google ScholarAikaterini GkaraveliView author publicationsSearch author on:PubMed Google ScholarFlorent DingliView author publicationsSearch author on:PubMed Google ScholarDamarys LoewView author publicationsSearch author on:PubMed Google ScholarGermano CecereView author publicationsSearch author on:PubMed Google ScholarContributionsN.A. and G.C. identified and developed the core questions of the work with the initial contribution of M.S. N.A. developed the miRNA-seq method on two-cell embryos and performed and analyzed most of the experiments. M.S. developed the strategy for yolk purification and small RNA-seq and performed all the initial experiments on yolk purification, small RNA-seq and data analysis. L.B. designed and generated all the CRISPR and AID strains used in this work and performed and analyzed the osmotic stress assay with the help of J.O. A.C. performed most of the bioinformatic analysis and developed a statistical method to calculate enriched miRNA in yolk. H.L.-M. helped in the initial development of the bioinformatic pipeline to analyze spike-in miRNA sequencing in two-cell embryos. P.-H.C. assisted M.S. in operating the FACS for yolk sorting. A.G. performed experiments contributing to Extended Data Fig. 2b. F.D. carried out the MS experimental work and D.L. supervised the MS and data analysis. G.C. supervised the whole work, contributed to the data analysis and wrote the paper with the contribution of N.A. and M.S.Corresponding authorCorrespondence to Germano Cecere.Ethics declarationsCompeting interestsThe authors declare no competing interests.Peer reviewPeer review informationNature Structural & Molecular Biology thanks Heng-Chi Lee, Björn Schumacher and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available. Primary Handling Editors: George Inglis, Melina Casadio and Carolina Perdigoto, in collaboration with the Nature Structural & Molecular Biology team.Additional informationPublisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.Extended dataExtended Data Fig. 1 Purification of VIT-2::GFP granules secreted into the body cavity and analysis of associated small RNAs.a, Schematic of yolk production and uptake in wild-type and RME-2 degron strains. In wild-type animals, yolk is synthesized in the intestine, secreted into the body cavity, and internalized by oocytes via the RME-2 receptor. In RME-2-depleted animals, yolk granules accumulate in the body cavity due to impaired uptake. b, Representative fluorescence images of VIT-2::GFP; RME-2 degron strains treated with or without 5-Ph-IAA in the presence (top) or absence (bottom) of TIR-1. At least 20 worms were analyzed for each condition and showing similar results. Scale bar is 25 μm. Fluorescence microscopy does not resolve the ultrastructural granularity of yolk particles; discrete yolk granules have been resolved previously by immune-electron microscopy9. c, Schematic of the yolk granule purification protocol: body cavity extracts are subjected to ultracentrifugation and fluorescent particle sorting. d, Dot blot analysis showing enrichment of VIT-2::GFP in purification fractions using anti-GFP antibody, corresponding to the scheme in panel c. e, Representative western blot of VIT-2::GFP using anti-GFP antibody in purification fractions, confirming enrichment as shown in panel c. Similar results were obtained in three different experiments. f, Sorting profiles of control N2 extracts (top: unstained, bottom: DiD-stained) showing GFP (R1) and DiD (R2) gating. g, Sorting profiles of VIT-2::GFP; RME-2 degron extracts (top: unstained, bottom: DiD-stained) showing gating strategy for GFP+ and DiD+ particles. Double-positive particles were sorted. h, Quantification of VIT-2::GFP fluorescence intensity in 2-cell embryos from RME-2 degron (no TIR-1) mothers treated with or without 5-Ph-IAA. Statistical analysis was performed using two-tailed Mann–Whitney–Wilcoxon tests. NS, not significant. The number of worms (n) is indicated in parentheses.Source dataExtended Data Fig. 2 Characterization of RME-2 degron strain and depletion of miRNAs in 2-cell embryos.a, MA-plot showing the log2 fold change of yolk-enriched miRNAs and mean expression levels of miRNAs from total worm lysate before yolk purification. n = 3 biological replicates. b, Bar plot showing VIT-2::GFP accumulation in the body cavity of animals expressing two RME-2 degron versions (AID and AID2). The AID version shows high VIT-2::GFP accumulation even under control conditions, indicating leaky degradation. c, MA-plot showing log2 fold change and mean expression of miRNAs in 2-cell embryos from control vs. 5-Ph-IAA–treated RME-2 degron mothers. Black circles: differentially expressed miRNAs (log2 fold change ≤ -0.5 or ≥ 0.5, FDR ≤ 0.05). Green: yolk-enriched miRNAs; Pink: germline-expressed miR-35 family; Other colored circles indicate miR-51 (black), miR-58 family (blue), and let-7 family (red). n = 3 biological replicates. d, MA-plot showing piRNA expression in 2-cell embryos from control vs. 5-Ph-IAA–treated RME-2 degron mothers. Differentially expressed piRNAs (log2 fold change ≤ -0.5 or ≥ 0.5, FDR ≤ 0.05) are shown in black circles. n = 3 biological replicates. See also Supplementary Table 3.Source dataExtended Data Fig. 3 Characterization of 2-cell embryo miRNA pools from Drosha Pasha (DP) degron strain.a, α-FLAG immunostaining showing DP localization in the intestine and germline of animals grown on control plates. Auxin treatment induces intestine-specific DP depletion, with germline expression unaffected. Nuclei are counterstained with DAPI (blue). Scale bar, 15 μm. b, VIT-2::GFP fluorescence in 2-cell embryos from DP degron animals lacking TIR1 grown with or without auxin. Black lines indicate means. Two-tailed Mann–Whitney–Wilcoxon test; NS, not significant. Sample sizes (n) are indicated in parentheses. c, MA plot of miRNA expression in 2-cell embryos from control versus auxin-treated DP degron mothers. Black circles indicate differentially expressed miRNAs (log2 fold change ≤ −0.5 or ≥ 0.5, FDR ≤ 0.05). Green, yolk-enriched miRNAs; pink, germline-expressed miR-35 family. n = 3 biological replicates. d, Venn diagram showing overlap of yolk-enriched miRNAs depleted in RME-2 (blue) and DP degron (purple) embryos. P values were calculated using one-sided Fisher’s exact test. e, Brood size of WT (N2), DP degron control, and auxin-treated mothers. Black lines indicate means. Two-tailed Mann–Whitney–Wilcoxon test. **P = 0.0020, ***P = 0.0001; NS, not significant. f, MA plot of miRNA expression in whole DP degron young adults with or without auxin. Black circles indicate differentially expressed miRNAs (log2 fold change ≤ −0.5 or ≥ 0.5, FDR ≤ 0.05). Blue, intestinal miRNAs; pink, miR-35 family. n = 3 biological replicates. g, MA plot of piRNA expression in DP degron young adults ± auxin. Differentially expressed piRNAs are shown in black (log2 fold change ≤ −0.5 or ≥ 0.5, FDR ≤ 0.05). n = 3 biological replicates. h, MA plot of piRNA expression in 2-cell embryos from DP degron mothers ± auxin. Differentially expressed piRNAs are shown in black. n = 3 biological replicates. See also Supplementary Table 3.Source dataExtended Data Fig. 4 Characterization of inherited miRNA targets in larvae.a, Genome browser views showing predicted miRNA binding sites on the 3′UTRs of the three most upregulated genes in DP degron larvae (log2 fold change ≥ 2; FDR ≤ 0.05): hrg-1, hrg-7, and clec-82. Target predictions were generated using TargetScanWorm 6.2. Red arrows indicate predicted sites for yolk-enriched miRNAs. b, Tissue enrichment and Gene Ontology analyses of upregulated genes in DP degron larvae. P value is calculated using the hypergeometric probability test and corrected using the Benjamini-Hochberg step-up algorithm. c, Representative fluorescent images displaying yolk persistence upon development of VIT-2::GFP progeny derived from mothers exposed to osmotic stress (300 mM NaCl, bottom) for 24 h or control (50 mM NaCl, top). Progenies at different embryonic and larval stages are displayed. Scale bar is 25 μm. Similar results were observed in at least three independent experiments. See also Supplementary Tables 3 and 4.Extended Data Fig. 5 Differential expression of miRNAs in 2-cell embryos derived from Day 1, Day 2, and Day 3 mothers.a, b, MA plots showing log2 fold change versus mean expression of miRNAs in 2-cell embryos collected from Day 2 (a) or Day 3 (b) mothers compared to Day 1 mothers. Black circles indicate significantly different miRNAs (log2 fold change ≤ –0.5 or ≥ 0.5; FDR ≤ 0.05). Green dots highlight yolk-enriched miRNAs; pink dots mark the germline-expressed miR-35 family. c, d, Volcano plots showing log2 fold change and significance of miRNA expression differences in embryos from Day 2 (c) or Day 3 (d) mothers versus Day 1. Colour coding is the same as in a, b. The data in d are also shown in Fig. 3c. e, Venn diagram showing the overlap between yolk-enriched miRNAs depleted in RME-2 degron (blue) and DP degron (purple) 2-cell embryos and yolk-enriched miRNAs in 2-cell embryos collected from day 3 mother (green). n = 3 biological replicates for all panels. See also Supplementary Table 3.Source dataExtended Data Fig. 6 Yolk-enriched miRNAs contribute to oxidative stress resilience and growth advantages associated with maternal age.a, Percentage of arrested L1 larvae after 72 h on paraquat (0.2, 0.3, or 0.4 mM). Progeny were derived from wild-type (N2) day 1 or day 3 mothers; larvae remaining at the L1 stage were scored as arrested. b, Larval size after 72 h on paraquat for progeny from DP degron mothers collected at day 1 or day 3 of egg laying. Mothers were grown with or without auxin from the L3 stage to induce intestine-specific depletion of miRNA biogenesis. Larval size was measured using a COPAS worm sorter. Statistical analysis was performed using two-tailed Mann–Whitney–Wilcoxon tests. *P = 0.0151; ****P