IntroductionHerpes simplex virus type 1 (HSV-1) is a DNA virus with a neuronal tropism and a high worldwide prevalence. HSV-1 can have both a lytic (productive) and a latent (dormant) stage of infection in cells. HSV-1 DNA can persist for life in a latent state in sensory (mostly trigeminal) and central nervous system (CNS) neurons [1]. While the most typical manifestation of HSV-1 infection occurs in the face or mouth, where it results in small groups of blisters, HSV-1 is also the leading cause of sporadic viral encephalitis in adults, often presenting with acute, necrotizing inflammation of the temporal lobes [2]. In addition, HSV-1 is a predominant cause of acute retinal necrosis [3]. Its lifelong presence in the CNS may also be associated with neurodegenerative diseases, like Alzheimer’s disease [4,5,6,7,8,9]. HSV-1 infection may lead to impairment of synaptic function and autophagic processes, as well as alterations in intracellular calcium dynamics [10] and mitochondrial activity [11]. Moreover, syncytial strains of HSV-1 infecting rat sensory neuronal cultures can cause fusion and electrical coupling between cells, leading to uncontrolled spike frequency and synchronous, spontaneous network activity [12].Beyond its implications in disease, HSV-1 has garnered significant attention in neuroscience as a potentially versatile platform for the delivery of therapeutic genes [13]. Gene therapy offers the possibility of specifically transferring therapeutic genes into diseased cells even in a highly heterogeneous tissue like the brain, and is therefore viewed as a promising alternative to currently available treatments of neurological disorders [14]. In this respect, the most developed approaches are based on viral vectors, in particular those derived from adeno-associated virus (AAV) or lentivirus (LV). Indeed, an AAV-based gene therapy is already available clinically for the treatment of spinal muscular dystrophy [15]. However, one important hurdle for the application of AAV or LV gene therapies to other neurological diseases is their limited cargo capacity. In many instances, an essential requirement for an effective therapeutic approach is the delivery of large genes or complex multigene cassettes. Therefore, the development of vectors able to accommodate large payloads is crucial and, in this respect, HSV-1 represents an optimal option [16].Multiple HSV-1-based vector types have been developed: replication-competent, replication-defective, and amplicons [17]. All these platforms have been obtained by modifying the viral genome, which consists of a linear molecule of double-stranded DNA, about 152 kb long. While this extraordinarily large genome offers the opportunity to transfer incomparably greater amounts of DNA than AAV or LV (theoretically, up to 40-50 kb with replication-defective, up to almost 150 kb with amplicon vectors), genetic engineering and manufacturing of HSV-1 vectors remains challenging [17, 18]. Thus, their use for neurological diseases is not yet common. However, HSV-1-based vectors are already clinically tested in other areas, e.g., a replication-defective HSV-1 vector, beremagene geperpavec, has been approved in the US for the treatment of wounds [19], and replication-competent HSV-1 vectors proved successful for oncolytic therapies [20].Considering the toxicity of wild-type HSV-1 infection in vivo in the CNS, modeling and characterization of the impact of HSV-derived vectors on cellular physiology is essential. In the present study, we tackled this issue by using the most recently developed vector backbone, namely the Joint deleted No Immediate 8 (J∆NI8) vector [17, 21]. This vector is deleted for the joint region and for the ICP0, ICP4 and ICP27 immediate-early (IE) genes. The ICP22 IE gene is converted to early-expression kinetics, such that no HSV IE gene gets expressed. In addition, the virion host shutoff gene (vhs, UL41) is also deleted, and bacterial sequences are removed [22]. After stereotactic injection in the brain, this vector backbone proved very safe (absence of detectable toxicity or inflammation) and ensured robust and long-lasting transgene expression [23]. Even if effective and reproducible protocols have been developed for the purification and storage of HSV vectors [18, 24], we noticed in the phase of clonal isolation that a few vector clones can display propensity to cause fusion of the transduced cells. These vector clones are usually negatively selected for further monoclonal expansion.Here, we explored the effects on neuronal physiology of some of these variants. We provide evidence that infection by replication-defective HSV-1-based vectors with mutations in UL27, the gene encoding for glycoprotein B, recapitulates many of the negative effects observed with wild-type HSV-1, namely alterations in basal electrophysiological properties of neurons and calcium homeostasis that ultimately led to hyperexcitability. These findings provide novel insights for monitoring and controlling genetic variations in HSV-1-based gene therapy vectors.Materials and methodsMaterialsCell culture media and reagents, if not otherwise stated, were from ThermoFisher Scientific (Carlsbad, CA, USA). Plates and flasks were from Nalgene Nunc (ThermoFisher Scientific). Petri dishes were from Falcon BD (Franklin Lakes, NJ, USA). Chemicals were from Tocris (Bristol, UK) or Merck-Sigma (Darmstadt, Germany).AntibodiesPrimary antibodies used for immunocytochemistry were: mouse anti-β-III-Tubulin - (Biolegend #801201, previously Covance #MMS-435P, dilution 1:1000) and mouse anti-Glial fibrillary acidic protein (GFAP) – (Sigma; G3893, dilution 1:250). Secondary antibody: Alexa Fluor 594 Goat anti-mouse (Invitrogen; A-11005, dilution of 1:250).Cell linesU2OS-ICP4/ICP27 complementing cell line has been generated (and kindly donated) by Yoshitaka Miyagawa through lentiviral transduction of the ICP4 and ICP27 HSV-1 genes into U2OS cells, allowing the stable expression of the transgene following infection. The ICP4 product is stably expressed but ICP27 must be induced by the viral function VP16. All these cells were maintained at 37 °C with 5% CO2 and grown in Dulbecco’s Modified Minimum Essential Medium (DMEM, Lonza) supplemented with 10% Fetal Bovine Serum (Gibco, Thermofisher), 2 mM L-glutamine (Gibco, Thermofisher), 100 U/mL Penicillin (Merck, Millipore), and 100 μg/ml Streptomycin (Merck, Millipore). Cells were routinely tested for mycoplasma contamination.Primary culture of rat hippocampal neuronsThe Institutional Animal Care and Use Committee of the San Raffaele Scientific Institute approved the animal use procedures. Primary cultures of hippocampal neurons were prepared according to [25] from 2 to 3-day-old Sprague–Dawley rats. Briefly, after brain removal from the skull, and quick subdivision of hippocampi into small pieces, the tissue was incubated into Hank’s solution containing 3.5 mg/mL trypsin type IX and 0.5 mg/mL DNase type IV for 5 min. The pieces were then mechanically dissociated in Hank’s solution supplemented with 12 mM MgSO4 and 0.5 mg/mL DNase IV. After centrifugation, cells were plated onto poly-ornithine coated coverslips and maintained in Neurobasal medium (ThermoFisher) supplemented with B27, 2 mM glutamax and 5 μM 1-β-D-cytosine-arabinofuranoside (Ara-C). Cultures were maintained at 37°C in a 5% CO2 humidified incubator.Viral titration in plaques forming units (p.f.u/ml)Titration of viral supernatant by plaque assay was performed on 48-well plates of U2OS-ICP4/ICP27 cells [22] at a density of 120,000 cells per well to achieve 80% confluency at the time of infection. Cells were infected with serial 10-fold dilutions of viral supernatant in 120 μl of DMEM (1% P/S, serum-free) media and incubated at 37 °C in 5% CO2 for approximately 3 hours. Subsequently, 100 μl of DMEM (1% P/S, serum-free) per well was added and the cells were incubated at 33 °C with 5% CO2 until lysis plaques formed (3-4 days). Plaque counts were performed by light or fluorescence microscopy and the result expressed as p.f.u./ml (plaque forming units per ml of viral preparation).Vector engineeringThe gB D285N and A549T mutations were introduced by scarless Red recombination, as described [22]. The necessary pBAD-IsceI and pEPkan-S2 plasmids were kindly provided by Nikolaus Osterrieder (Free University of Berlin, Berlin, Germany). The pgB1:D285N/A549T-kan plasmid described previously [21] was used as a template for amplification with primers gB-HA F (seq: GTTCCACCGGTACGGGACGACGGTAAACTGCATCGTCGAGGAGGTGGACG) and gB-HA R (seq: GGAGACGGCCATCACGTCGCCGAGCATCCGCGCGCTCACCCGCCGGCCCA), and the product was recombined with the native gB gene of KOS-37 BAC, followed by I-SceI-enhanced deletion of the aphAI gene in pBAD-I-sceI plasmid-transformed bacteria. Recombinants were confirmed by field inversion gel electrophoresis of restriction enzyme digested BAC DNAs and DNA sequencing across the gB genomic region.Virus growth curvesCells were plated at a density of 4 × 104 cell/well in 48-well plates (Corning) and infected the following day at MOI of 0.0005 genome copies (gc)/cell; MOI was determined by the average cell count of a monolayer of cells at the time of infection. Supernatants were collected every 24 h for up to 6 dpi. DNA was collected using the DNeasy blood and tissue kit (Qiagen) and total genome copies per sample were determined by real-time quantitative (q)PCR as previously described [22].High-scale viral productionViruses were propagated on U2OS-ICP4/ICP27 cells plated in T182 tissue culture flasks. In order to get high titer stocks, about 20 T182 flasks per virus have been used. Twenty-four hours before infection, U2OS-ICP4/ICP27 were plated as a 50% confluent monolayer in order to have about 90–100% confluent cells the day after. The amount of virus for infection was established by calibrating the multiplicity of infection (MOI, between 0.01 and 0.05), in serum-free media; the infected cells were incubated at 33 °C in 5% CO2.Four to five days after infection, supernatant was collected and separated from cellular debris by centrifugation at 3000 revolutions per minute (rpm) for 10 min, followed by filtration through a 0.8 μm Versapor filtering membrane (PALL Corporation). The virus was then concentrated by 19500 rpm centrifugation for 45’ and the viral pellet was resuspended in about 250 μl Phosphate-Buffered-Saline (PBS) 1X supplemented with 10% glycerol by slow overnight rotation at 4 °C. Table 1 summarizes the different viral batches used in this manuscript, the experiment in which they have been used, and the mutations detected in the gB gene.Table 1 Viral batches used in the manuscript, the experiment in which they have been used, and the mutations detected in the gB gene.Full size tableDNA extraction from J∆NI8 viral preparationTwenty uL of pure viral preparation were used to extract DNA for sequencing. DNA was extracted with DNeasy Blood & Tissue Kits (Qiagen) according to manufacturer’s instruction. Purified DNA was delivered to the Center for Omics Science at San Raffaele Scientific Institute.Classification analysis and variant callingThe classification analysis was performed with Kraken2 (version 2.1.1). Kraken is a taxonomic classification tool that uses exact k-mer matches to find the lowest common ancestor of a given sequence (Kraken2 is the newest version of Kraken). To classify the genomics reads, we use the standard Kraken database built with the “kraken-built” command.The sequencing reads were demultiplexed with Illumina bcl2fastq (version 2.20) and aligned to the HSV viral reference, KOS strain (https://www.ncbi.nlm.nih.gov/nuccore/JQ673480.1) by bwa-mem. SNP and small indel variants were detected by Freebayes and filtered with bcftools, according to the snippy (https://github.com/tseemann/snippy) pipeline (version 4.6).The key parameters we use in this analysis are (1) the minimum number of reads covering a site to be considered (set to 10); (2) the minimum proportion of those reads that must differ from the reference (set to 0.9); (3) the minimum VCF variant call “quality” used to filter variants (set to 100).J∆NI8 transduction of primary neuronsTo prevent osmotic shock at the time of infection, 1/3 (~400 μL) of the culture media of primary neurons, seeded on glass slides in a 24-well plate, was collected every three days and replaced with fresh medium. The conditioned medium was stored at 4 °C and used to resuspend the viral preparation. Eight days after seeding, the entire medium was collected and approximately 300 μL/well of conditioned medium were supplemented with the proper amount of viral volume (MOI 1; 200.000 neurons per slide) and added to the cells. Neurons were incubated for 1 h at 37 °C in 5% CO2. Subsequently, cells were washed with 300 μL of conditioned medium, and cells were then cultured with 2/3 of conditioned media and 1/3 of fresh one.ImmunofluorescenceNeurons were grown on glass coverslips in vitro, fixed with 4% paraformaldehyde solution, containing 4% sucrose in PBS. Primary and secondary antibodies were incubated for 1 h at RT, diluted in blocking solution (1% normal goat serum/0.1% Triton in PBS). Afterwards, coverslips were incubated with DAPI for 5’ at RT, deepened in water, and mounted on microscope slides with Fluorescence Mounting Medium (DAKO, Agilent).Imaging and analysisConfocal images have been acquired in the Advanced Light and Electron Microscopy BioImaging Center (Alembic). Images were acquired in an 8-bit format at a resolution of 1024 × 1024 pixels. For all images, we used a Leica SP8 confocal system equipped with an Acousto-Optical Beam Splitter which allows the selection of a specific frequency range for every fluorophore.Image compositionImage compositions were made with Adobe Illustrator cc 2017 (Adobe System, San Jose, CA, USA). Drawings were created with BioRender.com under a license granted to M.S.ElectrophysiologyPrimary culture slides were submerged in a recording chamber mounted on the stage of an upright BX51WI microscope (Olympus, Japan) equipped with differential interference contrast optics (DIC). Slides were continuously perfused with artificial cerebrospinal fluid (ACSF) containing (in mM): 125 NaCl, 2.5 KCl, 1.25 NaH2PO4, 2 CaCl2, 25 NaHCO3, 1 MgCl2 and 11 D- glucose saturated with 95% O2, 5% CO2 (pH 7.3) flowing at a rate of 2–3 ml/min at room temperature. Whole-cell patch-clamp recordings were performed using glass pipettes filled with a solution containing the following (in mM): 30 KH2PO4, 100 KCl, 2 MgCl2, 10 NaCl, 10 HEPES, 0.5 EGTA, 2 Na2-ATP, 0.02 Na-GTP, (pH 7.2, adjusted with KOH; tip resistance: 6–8 MΩ). For the dye-coupling experiments internal solution was modified by additional loading of 0.1% of Neuriobiotin-488 (LabVector).All recordings were performed using a MultiClamp 700B amplifier interfaced with a PC through a Digidata 1440 A (Molecular Devices, Sunnyvale, CA, USA). Data were acquired and analyzed using pClamp10 software (Molecular Devices). Voltage- and current-clamp traces were sampled at a frequency of 30 kHz and low-pass filtered at 2 kHz.Analysis of bursting activity was calculated by measuring the median instantaneous frequency with Clampfit Software (Molecular Devices). Instantaneous frequency is a measure of the inter-event intervals, which is the time between peaks, i.e. the time from the previous peak to the current peak. The final measure is calculated by first converting each inter-event interval into a frequency, and then averaging these frequencies together.Calcium measurement with Fura-2 calcium indicatorCa2+ measurements were performed in Krebs-Ringer-Hepes buffer (KRH - 5 mM KCl, 125 mM NaCl, 2 mM CaCl2, 1.2 mM MgSO4, 1.2 mM KH2PO4, 6 mM glucose and 20 mM Hepes, pH 7.4).Cells were loaded with 4 µM fura-2 acetoxymethyl ester (Thermo Fisher Scientific) for 40 min at 37°C. After dye loading, cells were washed twice with KRH and kept in the same buffer for the entire duration of the experiments.The single-cell experiments were performed with a video imaging setup consisting of an Axioskope 2 microscope (Zeiss, Oberkochen, Germany) and a Polychrome IV (Till Photonics, GmbH, Martinsried, Germany) light source. Fluorescence images were collected by a cooled CCD video camera (PCO Computer Optics GmbH, Kelheim, Germany). The ‘Vision’ software (Till Photonics) was used to control the acquisition protocol and to perform data analysis [26].Statistical analysisStatistical analysis was performed with GraphPad Prism software version 9.0 (GraphPad Software Inc., La Jolla, CA, USA). Results are given as dot plots or histograms with mean ± SEM as specified in the figure legends. The number of experiments and p-value are indicated in the figure legends, while biological replicates are shown as individual points in graphs. To assess for normal distribution of the data we applied the normality test (D’Agostino-Pearson) and equal variance test (Brown-Forsythe). Generally, in the case of normally distributed data, statistical significance was evaluated (with 95% confidence intervals) by one-way ANOVA followed by Dunnett post hoc test (for multiple comparisons against a single reference group), Newman–Keuls or Tukey’s post hoc test (for multiple comparisons between groups), two-tailed Student t-test (for comparisons between two average values); for samples with non-normal distributions, the nonparametric Mann–Whitney U test (for significant differences between two experimental groups) and the Kruskal–Wallis one-way analysis of variance followed by Dunn’s post hoc test (for the analysis of multiple experimental groups) were used. A value of P